Details

Created on Friday, 13 November 2020 18:01

This is amazing: a glib explanation of how the Covid vaccine was developed. It started with the Chinese figuring out the genome of Covid, which they published on January 10, just a month after the first cases were identified in Wuhon. Then, an American researcher took that genome, without questioning it, fed it into a computer, and it spit out the vaccine. And since then, it's been nothing but testing it on people. That's what you'll hear if you watch this:

https://www.msn.com/en-us/health/watch/scientists-moved-quickly-on-covid-vaccine-research-heres-how/vp-BB1aZpAQ?ocid=msedgdhp

Well, I went and found the published Chinese genome. I can't say I recognize all the lettering here, but I recognize some of it. Scroll down to where it says "Origin". That's what I recognize. It's the sequence of nitrogenous bases that comprise the genome. Those are the letters of the genetic alphabet, and there are four of them.: adenine, guanine, cytosine, and thymine. That's why you see in random sequence a,c,g, and t. Of course it's all scrambled as in atcgatgcagactgagatca etc. So, I get that except that in RNA there is no t. In DNA, it's t, but in RNA, it's u. Uracil replaces thymine in RNA. So, what this suggests to me is that those Chinese researchers didn't have the RNA. What they had was the manufactured and amplified DNA from the PCR test. And that's why their genome includes t instead of u.

https://www.ncbi.nlm.nih.gov/nuccore/MN908947

But, as David Crowe and Dr. Andy Kaufman have taught us, what the PCR test amplifies could be anything. And, it doesn't amplify a whole strand of DNA, rather, just a small part of it. So, how could these Chinese researchers claim to know the entire sequence of bases, nearly 30,000 of them, in Covid19? It's not as though they could look under a microscope and see all the bases. They didn't even have the whole virus. So, how did they come up with that list? It had to be done through computer modeling, where the computer compared what they came up with from the PCR test with other Corona viruses and speculated on what the entire chain was composed of. It's all computer-generated. But then what? Then we came along; accepted it all verbatim. And then we had our computers do a computer model of the vaccine based on their computer model of the viral genome. So, it's gross computer-generated speculation built upon gross computer-generated speculation. And the product of all that is what is being injected into people's bodies.