I’m lucky because I’m in a situation where I don’t think there is anything they can do to compel me to take a Covid vaccine. This article implies that the courts are going to support companies that require their workers to get vaccinated.

https://www.yahoo.com/news/employers-covid-19-vaccination-mandatory-163306940.html

Of course, schools already require childhood vaccinations, and some parents are choosing to home-school for that reason. I’ll mention again that Austin, Texas, where I live, is well known for being vaccination resistant, and the Waldorf School here does very well (there’s a waiting list to get into it) because they make vaccination optional. I’m sure that some parents send their kids there for no other reason. In other words, they’re not really interested in the philosophy of Rudolf Steiner.

Elsewhere in the news, a young American woman was sentenced to 4 months in prison for breaking her mandatory 14 day quarantine, although the sentence was reduced to 2 month in prison after the U.S. media reported it. But, the strange thing is that after she was sentenced and they took her away, there is video of it, and in the video, the young woman is masked but not her handlers. I put the picture up here:

http://oswaldinthedoorway.blogspot.com/2020/12/a-young-american-woman-was-sentenced-to.html

As of December 19, the CDC reported 6 severe reactions to the Covid vaccine. Everyone who gets it has to remain under observation for 15 minutes before they can leave.

6 severe allergic reactions reported from more than 250K COVID-19 vaccine shots (mynbc5.com)

The key word there is “severe.” We know that the effect can be life-threatening because they resorted to very high doses of steroids to save the nurse the in Alaska, and they wouldn’t have done that unless they had to. So, how many people experienced less than severe reactions, such as fever, headache, and malaise? And keep in mind that there are short-term adverse effects and long-term adverse effects; two very different things. No testing whatsoever has been done on the long-term adverse effects. They’ll find out what they are as time passes. Or will they? Since it’s a long-term effect, it’s not going to appear as a sudden reaction. It’s likely to manifest as chronic health problems that may not be unique to the vaccine. In other words, there will be plenty of room for “plausible deniability.”

No attempt was made to determine whether the vaccine prevents infection. What they looked for are symptoms, and their claim is that the vaccine will prevent the development of symptoms. But, the vast majority of study subjects who developed symptoms developed mild ones: extremely mild ones, such as a slight cough or a little sore throat. What is the point of taking a vaccine to prevent such symptoms?

The idea that the vaccine will prevent serious, life-threatening disease is just assumed.

But, we are in totally uncharted water because people have never been given this kind of vaccine before.

I continue to hear stories of cases that are unsettling. The latest is that of an older man (who is probably about my age) who went to the hospital for hernia surgery and there contracted Corona virus. So then, they tested his family, and some tested positive while others didn’t. His 7 year old grandson tested positive but wasn’t sick at all. Still, he had to go on quarantine for 14 days.

As for life getting back to normal, it’s not going to. There is no expectation that the vaccines are going to allow that to happen. Masking, social distancing, and the shuttering of group activities, they are with us for the foreseeable future. It’s pointless to project a date when it’s going to be over.

I’m sure glad I wasn’t born later.

 

Yesterday, the vaccinating of Americans with the Pfizer Covid vaccine began, starting with medical works, people in nursing homes, and others considered especially vulnerable. For me, it’s like watching lemmings tumble over the cliff. And, it’s like an episode of the Twilight Zone because it really does seem like we are in another dimension. Never before has an RNA vaccine been given to humans. I’ve heard many people say it alters DNA, but as I understand it, it’s more that it supplants your DNA. What does DNA do? It tells your cells what proteins to make. Well, this messenger RNA is going to tell your cells to make a toxic protein, and they know that it’s toxic. And then when it reaches the surface of the cells, the immune cells will respond by making antibodies to it, which is the immune response they are looking for. They claim that after that, the mRNA will be broken down and discarded, and that that happens right away. But, in that case, the therapeutic effect they are seeking is very temporary, and therefore, what good is it?  But, everything about this is very hypothetical. The fact is: it is an experiment.

The sad truth is that Medicine has become a global cult. That’s really what it is: a cult. It’s all about beliefs. The belief in the PCR test, which has never before been used the way it has been used for Covid. And even though there are indications screaming at us that the test isn’t valid, such as animals, foods, and inanimate objects testing positive for Covid, the belief in it goes on.  That’s because it’s a cult.

And the bizarre thing is that they don’t even expect it to stop infection. They just think it’s going to make it easier on people who get infected. But even if true, they can still infect others. Therefore, our Covid lifestyle must go on: with masks, social distancing, shutdowns, lockdowns, and quarantines.

I don’t even know for sure if the Covid virus exists at all. But, what I do know is that, whether it does or it doesn’t, they are diagnosing everything and anything as Covid, so long as the sick person tests positive for it. So, even if a person has had heart disease for decades, if they finally die of it, so long as they tested positive for Covid within the last month, they died, not of heart disease, but of Covid.  And that is a depraved situation. It is flagrantly corrupt.

Why does a person who hasn’t gotten Covid think they need the vaccine? Do they really think that the masking and social distancing they’ve done has kept them from getting it? Don’t they know that thousands of people who have been as diligent, and more diligent, than they have, have gotten it despite it all?  

So, what is going to be the outcome of this mass experiment? First, remember that in talking about the adverse effects of the vaccine, there are the short-term manifestations and the long-term ones. They think they know what to expect concerning short-term problems, and they expect there to be a significant amount of that. And they are fearful that many people who took the first shot will be unwilling to take the second one. But, they have no basis to claim anything about the long-term harms. That’s a black box, and they’ll find out what they are when they happen.

It’s encouraging that there is growing chorus of medical professionals who are fighting all this, and you can listen to some of them here, and they are from all over the world.

https://brandnewtube.com/watch/ask-the-experts-covid-19-vaccine-now-banned-on-youtube-and-facebook_qIsNohSIeSgfz2J.html

Someone asked me why I didn’t include Vitamin C among the supplements I take which I believe support my immunity. I don’t take Vitamin C as a separate supplement. I do take Core Multi from Klaire Labs, which I have taken for years, and it contains 400 mg of Vitamin C. And I probably get at least 500 mg/day from my diet because I eat so much fresh produce.  So, that’s 900 mg total, which is 10X the RDA. And I dare say that I think that’s enough. If there is any nutritional benefit from taking more Vitamin C than that, it’s got to be so small that it’s not worth worrying about. But notice that I said “nutritional” effect. Vitamin C can also be used therapeutically in much higher doses, but, as far as I’m concerned, it’s just something to consider doing temporarily because of circumstances. But for overall nutrition, I think what I’m getting is plenty, and I am not inclined to take more. Here is the link to the Core Multi that I take. It’s really very good. It is a very efficient and sufficient formula.

 https://klaire.com/lookfor/term/?q=Core+Multi

A good friend informed me that he got Covid. He is a retired professor in Ohio, about my age. He said that for 9 days, he experienced high fevers, weakness, body aches, but his respiratory symptoms were relatively mild. He did not have to be hospitalized, and he recovered spontaneously without treatment.

I asked him how it differed from his past experiences with the flu. He said the main difference was that he noticed the loss of taste and smell. But, I’d like to point out that that can happen with the regular flu, and even with colds, because any time you have inflammation in the upper respiratory tract, it can happen. But, people today are very tuned in to that symptom because they hear about it so much.

I asked him if he knows how he got it. He said that he was quarantining strictly, that he and his wife were having food delivered. He said he only left the house twice in recent weeks: once to go to his doctor’s office for routine blood tests, and once, to meet a friend at Panera’s where they enjoyed a meal. But, the friend was the only one he was exposed to at the restaurant without a mask, and this friend later was not sick and tested negative for Covid.

So, where does that leave it? It leaves it with no plausible explanation for how he got it. And if he could get it doing all the things that he was doing to stay safe, it certainly suggests that the masking that everyone is doing isn’t working.  

And, his case isn’t usual. Since he was NEVER around anyone who was visibly ill with it, his must have been a case of “asymptomatic spread.” The vast majority of cases are occurring that way. Recently, the CDC attributed half the transmissions to asymptomatic spread, however, no rational, scientific reason has ever been given why a disease which kills some people can cause not the slightest symptom in others. Covid is a deadly disease- except when it’s not.

I just read today that a nurse who was involved in a Covid vaccine trial experienced a severe reaction in which she experienced the highest fever she ever got in her life and other acute symptoms. Her narrative is being published in JAMA, a leading medical journal, along with an editorial saying that it is probably at the extreme of reactions that people are going to get from being vaccinated.  

However, I beg to differ. We know that the individual is always a variable in all pharmaceutical testing. Even if the percentage of people who experience severe reactions is small, they’re talking about vaccinating the whole country- hundreds of millions of people. With that many people involved, even an infinitesimal occurrence of severe reactions could be catastrophic. If half of Americans agree to take the vaccine, that would be over 150 million people. And it may be that more than half will take it since fear of Covid is so rampant.  

Then, there is Oregon medical doctor, a family practitioner, who proclaimed at pro-Trump rally that neither he nor his staff wear masks. This is what he said:

"We have been utterly duped, and I want you to know that this is insanity and the purpose is only to shut down the American people," Dr. LaTulippe said at the rally. "This is a threat to your freedom, a threat to our Constitution. I petition all of you, take off the mask of shame."

The Oregon medical board promptly suspended his license.

I am often asked what I take to support my immunity during this time of Covid. I haven’t altered anything. I haven’t started taking anything specifically because of Covid. But, there are things that I take routinely that I think are helping to protect me from infection, in general, including Covid. That includes hormones that I take, which are DHEA and melatonin, one in the morning, the other at night. Both strengthen the immune system. It includes Vitamin D3, 5000 IUs, which I take with my largest meal. And it includes iodine, which does more than support your thyroid. Iodine is an immune booster, and I take one Iodoral 12.5 mg. tablet daily. I get all of them pharmaceutical-grade from Klaire Labs. And I think that eating my plant-based diet of fresh fruits, green salads, steamed green vegetables, raw nuts and seeds, cooked beans and legumes, and limited whole grains is contributing mightily to my health. I think it’s protecting me a lot more than a mask.

 

 

I hear a lot of enthusiasm from people about the pandemic ending, that is, when we get the vaccine. They have the gleaming vision that the vaccine will be resoundingly effective; that it will be administered rapidly to all Americans; and after that, life will return to normal, and we’ll be able to go to theaters, attend concerts, and talk about all this in the past tense.

 

Well, they are not listening to Dr. Fauci because he says that even with the vaccine, life will not return to normal. He says that the vaccine will NOT prevent infection with the Corona virus. The only thing that the vaccines are expected to do is prevent serious illness among those who get infected, and it may even reduce their symptoms to zero. But, they are still going to get infected, and they will still be able to infect others. And therefore, the masking and social distancing will have to continue indefinitely even after the entire population is vaccinated.

 

So, when, pray-tell, are the pandemic, and the lifestyle it has wrought, going to end? That is the question reporters posed to Dr. Fauci, and his reply, given with a straight face, was: “That will depend on the second generation of vaccines.”

 

The second generation? Is he serious? Even the first generation is like pie in the sky, and now he’s talking about the second? And what they are claiming for the first generation has no credibility.  For instance, Pfizer claimed that of the 44,000 subjects in their study, only 94 developed any symptoms over 3 months, and that includes mild symptoms such as a mild cough or a mild sore throat or a mild fever. Only 94 out of 44,000? Who are these people? They’re obviously not like those I pass at the mall, or I should say, I used to pass.

 

And since when do you take a vaccine not to prevent infection but to prevent symptoms? Half the people who get Covid don’t get symptoms anyway, even without a vaccine. And that is practically the entire basis upon which the disease is continuing to spread. After all, among those coming down with Covid lately, what do you think they’re saying? That they let a guy with a bad cough, cough in their face? No, they are not saying that or anything like it. They’re saying that they don’t know how they got infected, that they don’t know how they were exposed because they haven’t been around anyone who was sick. That’s true in most all the new cases. So, since it’s obvious that mask-wearers and social distancers can still come down with Covid and quite easily, of what use are the masks and social distancing?

 

It reminds me of a great line in No Country For Old Men: If following the rules brought you to this, of what use were the rules?

 

Life is not going to go back to normal any time soon. And the outcome of the mass vaccination, about which there is so much hope and promise, could not only be a big disappointment, it could be disastrous.

 

And they’re telling us that the flu is practically non-existent this year. And they think it’s because the masking and social distancing work against the flu. Then, why don’t they work against Covid? Is it because Covid is very much more infectious and contagious than the flu?  But, how do they know that? Isn’t it just an assumption made out of convenience?

 

What’s going on is insane. And if you think your doctor knows a lot more about Covid than you do, think again. He or she may know a few more talking points than you do, but that’s about it.  They are just dogma-tees, like everyone else. And the Covid dogma has a lot more in common with religion than it does science.

 

Here is a conundrum: Let’s say a person has flu-like symptoms but tests positive for Covid. We know that in many people, Covid is asymptomatic. So, what if his Covid is asmptomatic but he also has the flu? One thing we can be sure of is: when in doubt, they are calling it Covid. For one thing, we know that hospitals, which are strapped for cash, get paid more money by the government if they call it Covid. We are in the midst of a Tulip Mania except it’s for Covid labeling. Have you noticed the ease at which they will attribute anything and everything to Covid? It began as a respiratory virus. Now, it is the virus that can go anywhere and do anything. And it may bypass the respiratory system completely. Or it may do nothing. Nothing at all.

 

When Autumn comes around, I shift my eating pattern, and there are certain foods I go to at this time of year.

Texas Red Grapefruit- I live in Texas, and it is plentiful here. I don’t know how available it is in other places. But, Texas Ruby Red or Star Ruby grapefruit is the best in the world, or at least, the best I’ve ever had. And that red color is due to lycopene. So, guys, every time you eat it, you are helping to protect your prostate. Lycopene is also protective of the lungs, so in these Covid times, why not eat some? I eat it almost every day this time of year.

Other Citrus- Navel oranges appear in late October/early November, but they tend to be very acidic and don’t really get good and ripe until December, and maybe not even until January. So, I don’t buy them in the fall. However, the mandarin oranges are very nice this time of year. They ripen up nicely this early, and that’s what I am buying and eating now.  

Comice pears are the king of pears. It’s a French pear, and in the U.S., it is only grown commercially in one place: the very top of Northern California and the very bottom of Oregon, an area called the Red River Valley.  It’s the only place here that has the right soil and climate to grow them. But, they are delicious; truly a desert pear; sweet, juicy, and flavorful. They are only available in the fall, you might as well eat them.

Perimmons are a very highly mineralized fruit and 4% mineral ash. That’s high. Persimmons are very sweet, and they are like Nature’s jam. And that’s how Ieat them. I don’t just sit down and eat a persimmon. I find that it’s too sweet to do that. But, I add them to oatmeal, or I might make a sandwich out of whole grain bread, nut butter, and persimmon.  And I guarantee you kids will like them too.

Pomegranates are considered a super-food because they contain unique nutrients called punicaligans that are found nowhere else that are very cardio-protective. They help keep your arteries clear and healthy. They also support the immune system. Pomegranates are expensive but a lot cheaper than medical care for heart disease which really only harms you anyway.

Dark Leafy Greens such as kale, collards, and mustard greens, and also Asian greens such as bok choy come into their own in cool weather because they like it. It makes them sweet and succulent. I’m lucky because I have a garden, and tonight I ate bok choy from my garden. I fixed some tonight, and all I do is steam it for about 5 minutes, and then I dress it with sesame tahini and garlic powder. No salt is needed. I also have kale growing, and it’s almost big enough to harvest. But, in the meantime, I buy these 3 pound bags of washed, cut and stemmed, organic kale at the supermarket. And for that, I steam it for 5 to 8 minutes, and then I dress it with extra virgin olive oil and garlic powder. Again, no salt. You do not need it. There is naturally occurring sodium in these greens, as well as every other mineral that you need.

Nuts and Seeds become available as a new crop in the fall. I buy a bunch and freeze them because they keep better that way. They are high in oil, and it’s very perishable. Almonds with the skins on hold up the best because that skin seals them pretty darn good. But, pecans can turn rancid easily, and Texans know that they are best stored in the freezer. They don’t actually freeze. They get rather brittle, but you can actually eat them right out of the freezer. I do the same with sunflower seeds; I buy the new crop in the fall and store them in the freezer.

Sweet potatoes and winter squashes: The new  crop of these are also available, but the early sweet potatoes aren’t that sweet. A sweet potato really has to “cure” a while before its sugars form. So, I am not hasty about buying sweet potatoes. But, the winter squashes are good now, such as acorn and butternut.

 

Well, I hope this has helped you. I am a strong believer in the power of plant foods. And it really is wonderful to get into this kind of eating. And before long, you forget about the other stuff. I’m eating better than anybody on the planet, as far as I’m concerned- unless they are eating like me.  

 

 

 

 

To say that government, media, and Big Pharma are overreacting, with glee, to their recent claims about the Covid vaccines is the understatement of the century. But, doctors, who should know better, are eating it up too, and that's both ominous and pathetic. 

They're claiming that the vaccines of Pfizer and Moderna are safe, but how do the know when they’ve only been studied for a relatively few weeks, and it’s known that the harms from vaccines may take months and years to manifest?  They know nothing about the long-term adverse effects, so they just assume there aren’t any.

They don’t know how long the claimed protection will last, but even their optimistic projections only hope for a year, and they presume that an annual shot will be needed- for life- and they have no idea how safe that is.

Both Pfizer and Moderna are doing their trials on groups of people with incredibly low risk of developing Covid. Pfizer’s group resulted in less than one-tenth of one percent of participants getting Covid. Moderna’s group involved three-tenth of one percent getting Covid. And in both cases, that included the unvaccinated. Why is a vaccine needed for such people if well over 99% of them don’t get the disease even without protection?

And how did they identify Covid cases? Remember that Covid is a disease whose symptomatology ranges from nothing to death. It’s been estimated that half of Covid infectees don’t get any symptoms at all. But, supposedly, they can still infect others. So, wasn’t it important to consider those people? But, they were NOT considered. You had to have at least one symptom in order to be tested.

So, let’s say you developed a mild cough during the study and nothing else. That’s considered a symptom of Covid, so, they would test you. But, nothing is also a symptom of Covid. And coughs can be symptoms of coughs and flus and other illnesses. So, who is to say that the cough was due to Covid? Maybe the guy was among those who don’t get symptoms from Covid, but he happened to have a cold, and his cough was due to the cold. Why couldn’t a person with a cough from a cold also manifest a positive PCR test when animals and inanimate objects have manifested positive PCR tests?  So, they don’t know what they are measuring, and they don’t know what they are doing. They don’t know who’s got what.  They’re just assuming.

But, the worst thing of all is that in the Pfizer study, they are only looking at the results among 94 people out of 43,438. It’s like they might as well have done the whole study on just those 94 people. The purpose of those other people, the other 43,344, was to show just how difficult it is to get Covid. 

And what a healthy group of people they picked. Don’t you think it’s odd that out of 43,438 people watched for several months that less than one-tenth of one percent developed the slightest symptom, such as a cough or sore throat? Obviously, they weren’t representative of the general public if so few of them got the least bit sick over that much time. None of the trials have been looking for reduced incidence of serious illness, reduced need for hospitalization, or lowered risk of death. What use is there in taking a vaccine merely to prevent a cough? The excuse given was that they would have had to wait forever to compile a meaningful list of people with serious disease- and I agree, since none of their 43,438 developed serious disease. But, if that’s the case, then what do they need a vaccine for? To prevent coughs?

Vaccinating people for a disease with a fatality rate of just a tiny fraction of one percent practically guarantees that the harms of the vaccine are going to outweigh the benefits.  Then, when you consider how common coughs are, even without Covid, and how flaky that PCR test is, with its myriad false-positive test results, it means that they may not be measuring anything at all, that there is nothing clinically significant about anything they are doing.

Yet, despite these sober realities, people are getting all worked up about the coming Covid vaccines. That lay people do it is bad enough, but that doctors do it is an absolute disgrace. Dr. Fauci is an idiot; an ignoramus. He shouldn’t be taking splinters out of people. I doubt he could do that right, the moron.

So, where’s this all heading? To no place good. And if you’re thinking of getting a Covid vaccine, I pity you. I really do. 

 

 

 

 

  

 

Perhaps you realize that, even before Covid, my attitude towards conventional Medicine stunk out loud. But since Covid, it has only gone from bad to worse.

But, let’s start with pre-Covid. I pretty much hated Medicine even before Covid.  Large swaths of it I considered to be dangerous; a menace to health. For instance, take cardiologists: what good are they? They throw deleterious drugs at people- and all the drugs they use are dangerous and harmful. And their entire approach to heart problems is just gimmicks. A person has swollen legs from heart failure, so they put them on a diuretic to try to dry up their legs. But, it's just a gimmick, and it NEVER works very well. Sure, it may reduce the fluid a little, but not much. It certainly doesn’t cure the problem. And remember: the legs don’t swell from the lack of a diuretic. It’s just a way of imposing pharmaceutical tinkering on a person that has no hope of restoring normality and is sure to cause havoc and complications. You're just digging yourself in deeper when you do that sh_t. 

Cholesterol high? Then put them on a drug that disrupts cholesterol production by the liver and causes other nasty harms. And all you get for that worthless havoc is a prettier cholesterol number. All you have to show for it afterwards is a more attractive blood test. Are you healthier? Not in the least, and you are probably sicker.

Drugs to lower blood pressure? They all work by disrupting or impairing some normal mechanism. Having high blood pressure isn’t normal, but taking their drugs is only going to put you further away from normal. Perhaps in a hypertensive emergency, where all the signs point to an imminent stroke, you have no choice. But, I am referring to your garden variety hypertension, where on an annual visit, your doctor says, “140/90. I know you’re not feeling anything, but your blood pressure is starting to creep up. So, let’s get you started on medication, and don’t worry about it, because you’re just at that point in life. It happens to everybody, or nearly everybody. No big deal.” If your doctor tells you something like that, you need to instantly get up, get your stuff, and get the hell out of there. And never go back to him again.

Gastroenterologists? Oh God, are they worthless. With their proton pump inhibitors which, like the blood pressure drugs, are a life sentence. Even the desired and intended effect of destroying stomach acid is a bad thing, never mind all the other harmful effects. With their miserable and dangerous drugs for chronic constipation and irritable bowel. With their dangerous regimens for inflammatory bowel disease and Crohn’s. I had a beloved cousin who had Crohn’s disease since he was a teenager, and he was under medical care his whole adult life, until he finally died of intestinal cancer.

I had a guest at my health retreat who had high blood pressure for many years and was treated by one of the top cardiologists in Atlanta- and then he went on to develop heart failure. But don't worry: the cardiologist had drugs for that too. But, did he ever consider the possibility that his treatment of the high blood pressure is what led to the heart failure? Of course not. 

Then, there are the orthopedists. I have a guy at my health retreat right now, in his 50s, an athlete, and I mean he has been athletic his whole life; a big burly guy. He’s into field sports: shot put, discus, and javelin throwing. Well, he developed a shoulder problem, and he went to see a leading orthopedist in Dallas who took one look at his x-ray and told him that he needed a total shoulder replacement. Fortunately, the guy was smart enough to get out of there. That was years go, and as he showed me, he’s still got some restriction in his shoulder. He can’t raise his arm much overhead. But, he can live with it. He's getting by. It certainly doesn’t warrant having a total shoulder replacement. Do you realize how radical and drastic that is?

And then there is the whole vaccination racket, which brings us back to Covid. Now, let me tell you something, and I hope you will take this to heart. Do you know what your doctor knows about vaccinations, even If he administers them all day long? What he knows are a few more talking points than you know. That’s it. It’s just as much a matter of faith for him as it is for you. He believes in it because it’s a dogma that he’s been taught his whole life. It’s supposed to be science, but really, it’s more like religion.

And now to Covid: What I have seen over these past 10 months is the capitulation of medical doctors and whole medical community to the CDC and it’s “pandemic.” It’s a pandemic based on a bogus test, in which they admit that if you cycle it enough times, that ANYONE can test positive for Covid. And be aware that people have been added to the Covid roles just for being suspected, without even getting a positive test. Doctors have taken people with established heart disease who died of heart-related problems, who, because they tested positive for Covid before they died, were said to die of Covid. They recently took an 18 year old boy who died of sudden cardiac arrest, who repeatedly tested negative for Covid, but when they finally got a positive test, they decided that it was accurate, and therefore, he died of Covid too. He never even had respiratory symptoms. 

Medicine is a menace. They are a menace for what they think and for what they do. And I realize that they do some good things. They do some fabulous things. I mentioned months ago that I underwent inguinal hernia repair in January, and it went extremely well. I am completely satisfied. I am as good as new down there. And the surgery was a piece of cake. However, I did it my way. I didn’t go to a conventional surgeon who would have put a plastic mesh in me. I flew to Florida and had a doctor trained in the Desarda technique, out of India, where they divide the external oblique aponeurosis to create a new pelvic floor with it. And it worked like a charm. I healed very quickly. I was practically back to normal in two weeks. I feel solid and secure down there, and my post-surgical pain was minimal. If I moved a certain way, it might stab a little, but I experimented and found a comfortable position, and if I maintained it, I was fine. I easily got through it without drugs. But, even this surgeon, as good as he was, got carried away with the drugs. He prescribed painkillers, antibiotics, and anti-inflammatories, and I didn’t take any of them. And I healed very fast and very thoroughly.

Then recently, 10 days ago to be exact, I had an accident on my bicycle. I rode into a protruding metal spike on a parked trailer. I’m not saying that it wasn’t my fault because I should have been paying attention. But, the first thing I knew, it was gouging the hell out my leg, and I mean deeply; I mean past the skin down to the fascia. The tissue spurted out of me. I almost fell off the bike, but fortunately I didn’t. So, I got off and inspected it, and I realized it was bad. I didn’t see anyone around. I was tempted to knock on a door and ask to be driven home- or to the hospital. But, I didn’t. I just took my shirt off and tied it around the wound, like a tourniquet. Well, not as tight as a tourniquet because I didn't rupture an artery, but tight enough to curtail the bleeding. And then I started slowly riding home. I had about 2 miles to go. But, someone had seen me from a window, and he jumped in his truck and came after me, which was very nice of him.  He put my bike in the back of his truck and drove me home.

So, I got in the tub and ran the water on it, trying to flush it out. I did, and I could see that it was really deep. So, I bandaged it with gauze and cling-wrap, and then I headed to the nearest Medi-Clinic. It took 18 stitches to sew me up: 3 internal and 15 external. And believe me, I am grateful because it really looked bad. They wanted me to take a tetanus shot, but I declined. They wanted me to take antibiotics, but I declined. And they wanted me to take painkillers, but I declined. And the healing went very well. I got the stitches out today, and it looks knit. I'm going to have a scar there, but who cares because I am whole and intact again. And I am riding my bike again too but with a lot more attention to what's ahead. My point is that they helped me, but I skipped the parts that I didn’t need.

But honestly, I am, for the most part, scared sh_tless of MDs, and the less I have to do with them the better. I would never think of going in for an annual physical. Forget it. I’m 70 years old, and as long as I’m feeling good, I am leaving well enough alone. 

But don’t get me wrong, I wouldn’t take it to the point of foolishness. If I had a skin cancer that could be easily excised, I would let them do it, especially today because they have such excellent techniques, such as the Mohs method. If I had cataracts, I would certainly consider getting a lens implant. But, it would have to be good and ripe. I wouldn’t rush into it. And that's something I probably will need if I live long enough. If I had a full-blown bacterial pneumonia, I suppose I would take an antibiotic, but I have never had pneumonia in my life, not even a mild case.

I am never going to get any joint replacement surgeries. That I’ve decided. I’ll hobble around if I have to, but I just won't do it. A coronary bypass? No way ever, although honestly, it’s not in the cards for me. Ralph Cinque? Come on; don't be ridiculous. The heart surgeon should only wish his arteries were as good as mine. Chemotherapy for cancer? No. I am not doing that either. I've seen too many people who have. 

So, there is a heck of a lot in Medicine that I wouldn't do even if it were free to me. But, what Covid has taught me is the extent to which Medicine is a religion, and it’s a greater extent than I previously thought. There is a dangerous homogeneity in Medicine, where most doctors think and act the same and follow the book. And that’s what bothers me the most, that most doctors are automations; they are not capable of independent thinking.  They spew their talking points and repeat their mantras, but they aren't really thinking.

Staying free of medical clutches- that's my goal.  It's my life plan as I enter my 8th decade. And the Covid pandemic has only made me more certain that largely avoiding Medicine will increase my chances of having a great 8th decade- and beyond. They’ll be no Covid vaccine for me- nor any other kind of vaccine. Modern Medicine is something I mostly want to to avoid, and I believe my life will be better for it.  Of course, I believe in taking care of myself with proper nutrition, exercise, and life habits, and I am doing that. There's the rub.  

This is amazing: a glib explanation of how the Covid vaccine was developed. It started with the Chinese figuring out the genome of Covid, which they published on January 10, just a month after the first cases were identified in Wuhon. Then, an American researcher took that genome, without questioning it, fed it into a computer, and it spit out the vaccine. And since then, it's been nothing but testing it on people. That's what you'll hear if you watch this:

https://www.msn.com/en-us/health/watch/scientists-moved-quickly-on-covid-vaccine-research-heres-how/vp-BB1aZpAQ?ocid=msedgdhp

Well, I went and found the published Chinese genome. I can't say I recognize all the lettering here, but I recognize some of it. Scroll down to where it says "Origin". That's what I recognize. It's the sequence of nitrogenous bases that comprise the genome. Those are the letters of the genetic alphabet, and there are four of them.: adenine, guanine, cytosine, and thymine. That's why you see in random sequence a,c,g, and t. Of course it's all scrambled as in atcgatgcagactgagatca etc. So, I get that except that in RNA there is no t. In DNA, it's t, but in RNA, it's u. Uracil replaces thymine in RNA. So, what this suggests to me is that those Chinese researchers didn't have the RNA. What they had was the manufactured and amplified DNA from the PCR test. And that's why their genome includes t instead of u.

https://www.ncbi.nlm.nih.gov/nuccore/MN908947

But, as David Crowe and Dr. Andy Kaufman have taught us, what the PCR test amplifies could be anything. And, it doesn't amplify a whole strand of DNA, rather, just a small part of it. So, how could these Chinese researchers claim to know the entire sequence of bases, nearly 30,000 of them, in Covid19? It's not as though they could look under a microscope and see all the bases. They didn't even have the whole virus. So, how did they come up with that list? It had to be done through computer modeling, where the computer compared what they came up with from the PCR test with other Corona viruses and speculated on what the entire chain was composed of. It's all computer-generated. But then what? Then we came along; accepted it all verbatim. And then we had our computers do a computer model of the vaccine based on their computer model of the viral genome. So, it's gross computer-generated speculation built upon gross computer-generated speculation. And the product of all that is what is being injected into people's bodies.

 

More Articles...