To say that government, media, and Big Pharma are overreacting, with glee, to their recent claims about the Covid vaccines is the understatement of the century. But, doctors, who should know better, are eating it up too, and that's both ominous and pathetic. 

They're claiming that the vaccines of Pfizer and Moderna are safe, but how do the know when they’ve only been studied for a relatively few weeks, and it’s known that the harms from vaccines may take months and years to manifest?  They know nothing about the long-term adverse effects, so they just assume there aren’t any.

They don’t know how long the claimed protection will last, but even their optimistic projections only hope for a year, and they presume that an annual shot will be needed- for life- and they have no idea how safe that is.

Both Pfizer and Moderna are doing their trials on groups of people with incredibly low risk of developing Covid. Pfizer’s group resulted in less than one-tenth of one percent of participants getting Covid. Moderna’s group involved three-tenth of one percent getting Covid. And in both cases, that included the unvaccinated. Why is a vaccine needed for such people if well over 99% of them don’t get the disease even without protection?

And how did they identify Covid cases? Remember that Covid is a disease whose symptomatology ranges from nothing to death. It’s been estimated that half of Covid infectees don’t get any symptoms at all. But, supposedly, they can still infect others. So, wasn’t it important to consider those people? But, they were NOT considered. You had to have at least one symptom in order to be tested.

So, let’s say you developed a mild cough during the study and nothing else. That’s considered a symptom of Covid, so, they would test you. But, nothing is also a symptom of Covid. And coughs can be symptoms of coughs and flus and other illnesses. So, who is to say that the cough was due to Covid? Maybe the guy was among those who don’t get symptoms from Covid, but he happened to have a cold, and his cough was due to the cold. Why couldn’t a person with a cough from a cold also manifest a positive PCR test when animals and inanimate objects have manifested positive PCR tests?  So, they don’t know what they are measuring, and they don’t know what they are doing. They don’t know who’s got what.  They’re just assuming.

But, the worst thing of all is that in the Pfizer study, they are only looking at the results among 94 people out of 43,438. It’s like they might as well have done the whole study on just those 94 people. The purpose of those other people, the other 43,344, was to show just how difficult it is to get Covid. 

And what a healthy group of people they picked. Don’t you think it’s odd that out of 43,438 people watched for several months that less than one-tenth of one percent developed the slightest symptom, such as a cough or sore throat? Obviously, they weren’t representative of the general public if so few of them got the least bit sick over that much time. None of the trials have been looking for reduced incidence of serious illness, reduced need for hospitalization, or lowered risk of death. What use is there in taking a vaccine merely to prevent a cough? The excuse given was that they would have had to wait forever to compile a meaningful list of people with serious disease- and I agree, since none of their 43,438 developed serious disease. But, if that’s the case, then what do they need a vaccine for? To prevent coughs?

Vaccinating people for a disease with a fatality rate of just a tiny fraction of one percent practically guarantees that the harms of the vaccine are going to outweigh the benefits.  Then, when you consider how common coughs are, even without Covid, and how flaky that PCR test is, with its myriad false-positive test results, it means that they may not be measuring anything at all, that there is nothing clinically significant about anything they are doing.

Yet, despite these sober realities, people are getting all worked up about the coming Covid vaccines. That lay people do it is bad enough, but that doctors do it is an absolute disgrace. Dr. Fauci is an idiot; an ignoramus. He shouldn’t be taking splinters out of people. I doubt he could do that right, the moron.

So, where’s this all heading? To no place good. And if you’re thinking of getting a Covid vaccine, I pity you. I really do. 

 

 

 

 

  

 

Perhaps you realize that, even before Covid, my attitude towards conventional Medicine stunk out loud. But since Covid, it has only gone from bad to worse.

But, let’s start with pre-Covid. I pretty much hated Medicine even before Covid.  Large swaths of it I considered to be dangerous; a menace to health. For instance, take cardiologists: what good are they? They throw deleterious drugs at people- and all the drugs they use are dangerous and harmful. And their entire approach to heart problems is just gimmicks. A person has swollen legs from heart failure, so they put them on a diuretic to try to dry up their legs. But, it's just a gimmick, and it NEVER works very well. Sure, it may reduce the fluid a little, but not much. It certainly doesn’t cure the problem. And remember: the legs don’t swell from the lack of a diuretic. It’s just a way of imposing pharmaceutical tinkering on a person that has no hope of restoring normality and is sure to cause havoc and complications. You're just digging yourself in deeper when you do that sh_t. 

Cholesterol high? Then put them on a drug that disrupts cholesterol production by the liver and causes other nasty harms. And all you get for that worthless havoc is a prettier cholesterol number. All you have to show for it afterwards is a more attractive blood test. Are you healthier? Not in the least, and you are probably sicker.

Drugs to lower blood pressure? They all work by disrupting or impairing some normal mechanism. Having high blood pressure isn’t normal, but taking their drugs is only going to put you further away from normal. Perhaps in a hypertensive emergency, where all the signs point to an imminent stroke, you have no choice. But, I am referring to your garden variety hypertension, where on an annual visit, your doctor says, “140/90. I know you’re not feeling anything, but your blood pressure is starting to creep up. So, let’s get you started on medication, and don’t worry about it, because you’re just at that point in life. It happens to everybody, or nearly everybody. No big deal.” If your doctor tells you something like that, you need to instantly get up, get your stuff, and get the hell out of there. And never go back to him again.

Gastroenterologists? Oh God, are they worthless. With their proton pump inhibitors which, like the blood pressure drugs, are a life sentence. Even the desired and intended effect of destroying stomach acid is a bad thing, never mind all the other harmful effects. With their miserable and dangerous drugs for chronic constipation and irritable bowel. With their dangerous regimens for inflammatory bowel disease and Crohn’s. I had a beloved cousin who had Crohn’s disease since he was a teenager, and he was under medical care his whole adult life, until he finally died of intestinal cancer.

I had a guest at my health retreat who had high blood pressure for many years and was treated by one of the top cardiologists in Atlanta- and then he went on to develop heart failure. But don't worry: the cardiologist had drugs for that too. But, did he ever consider the possibility that his treatment of the high blood pressure is what led to the heart failure? Of course not. 

Then, there are the orthopedists. I have a guy at my health retreat right now, in his 50s, an athlete, and I mean he has been athletic his whole life; a big burly guy. He’s into field sports: shot put, discus, and javelin throwing. Well, he developed a shoulder problem, and he went to see a leading orthopedist in Dallas who took one look at his x-ray and told him that he needed a total shoulder replacement. Fortunately, the guy was smart enough to get out of there. That was years go, and as he showed me, he’s still got some restriction in his shoulder. He can’t raise his arm much overhead. But, he can live with it. He's getting by. It certainly doesn’t warrant having a total shoulder replacement. Do you realize how radical and drastic that is?

And then there is the whole vaccination racket, which brings us back to Covid. Now, let me tell you something, and I hope you will take this to heart. Do you know what your doctor knows about vaccinations, even If he administers them all day long? What he knows are a few more talking points than you know. That’s it. It’s just as much a matter of faith for him as it is for you. He believes in it because it’s a dogma that he’s been taught his whole life. It’s supposed to be science, but really, it’s more like religion.

And now to Covid: What I have seen over these past 10 months is the capitulation of medical doctors and whole medical community to the CDC and it’s “pandemic.” It’s a pandemic based on a bogus test, in which they admit that if you cycle it enough times, that ANYONE can test positive for Covid. And be aware that people have been added to the Covid roles just for being suspected, without even getting a positive test. Doctors have taken people with established heart disease who died of heart-related problems, who, because they tested positive for Covid before they died, were said to die of Covid. They recently took an 18 year old boy who died of sudden cardiac arrest, who repeatedly tested negative for Covid, but when they finally got a positive test, they decided that it was accurate, and therefore, he died of Covid too. He never even had respiratory symptoms. 

Medicine is a menace. They are a menace for what they think and for what they do. And I realize that they do some good things. They do some fabulous things. I mentioned months ago that I underwent inguinal hernia repair in January, and it went extremely well. I am completely satisfied. I am as good as new down there. And the surgery was a piece of cake. However, I did it my way. I didn’t go to a conventional surgeon who would have put a plastic mesh in me. I flew to Florida and had a doctor trained in the Desarda technique, out of India, where they divide the external oblique aponeurosis to create a new pelvic floor with it. And it worked like a charm. I healed very quickly. I was practically back to normal in two weeks. I feel solid and secure down there, and my post-surgical pain was minimal. If I moved a certain way, it might stab a little, but I experimented and found a comfortable position, and if I maintained it, I was fine. I easily got through it without drugs. But, even this surgeon, as good as he was, got carried away with the drugs. He prescribed painkillers, antibiotics, and anti-inflammatories, and I didn’t take any of them. And I healed very fast and very thoroughly.

Then recently, 10 days ago to be exact, I had an accident on my bicycle. I rode into a protruding metal spike on a parked trailer. I’m not saying that it wasn’t my fault because I should have been paying attention. But, the first thing I knew, it was gouging the hell out my leg, and I mean deeply; I mean past the skin down to the fascia. The tissue spurted out of me. I almost fell off the bike, but fortunately I didn’t. So, I got off and inspected it, and I realized it was bad. I didn’t see anyone around. I was tempted to knock on a door and ask to be driven home- or to the hospital. But, I didn’t. I just took my shirt off and tied it around the wound, like a tourniquet. Well, not as tight as a tourniquet because I didn't rupture an artery, but tight enough to curtail the bleeding. And then I started slowly riding home. I had about 2 miles to go. But, someone had seen me from a window, and he jumped in his truck and came after me, which was very nice of him.  He put my bike in the back of his truck and drove me home.

So, I got in the tub and ran the water on it, trying to flush it out. I did, and I could see that it was really deep. So, I bandaged it with gauze and cling-wrap, and then I headed to the nearest Medi-Clinic. It took 18 stitches to sew me up: 3 internal and 15 external. And believe me, I am grateful because it really looked bad. They wanted me to take a tetanus shot, but I declined. They wanted me to take antibiotics, but I declined. And they wanted me to take painkillers, but I declined. And the healing went very well. I got the stitches out today, and it looks knit. I'm going to have a scar there, but who cares because I am whole and intact again. And I am riding my bike again too but with a lot more attention to what's ahead. My point is that they helped me, but I skipped the parts that I didn’t need.

But honestly, I am, for the most part, scared sh_tless of MDs, and the less I have to do with them the better. I would never think of going in for an annual physical. Forget it. I’m 70 years old, and as long as I’m feeling good, I am leaving well enough alone. 

But don’t get me wrong, I wouldn’t take it to the point of foolishness. If I had a skin cancer that could be easily excised, I would let them do it, especially today because they have such excellent techniques, such as the Mohs method. If I had cataracts, I would certainly consider getting a lens implant. But, it would have to be good and ripe. I wouldn’t rush into it. And that's something I probably will need if I live long enough. If I had a full-blown bacterial pneumonia, I suppose I would take an antibiotic, but I have never had pneumonia in my life, not even a mild case.

I am never going to get any joint replacement surgeries. That I’ve decided. I’ll hobble around if I have to, but I just won't do it. A coronary bypass? No way ever, although honestly, it’s not in the cards for me. Ralph Cinque? Come on; don't be ridiculous. The heart surgeon should only wish his arteries were as good as mine. Chemotherapy for cancer? No. I am not doing that either. I've seen too many people who have. 

So, there is a heck of a lot in Medicine that I wouldn't do even if it were free to me. But, what Covid has taught me is the extent to which Medicine is a religion, and it’s a greater extent than I previously thought. There is a dangerous homogeneity in Medicine, where most doctors think and act the same and follow the book. And that’s what bothers me the most, that most doctors are automations; they are not capable of independent thinking.  They spew their talking points and repeat their mantras, but they aren't really thinking.

Staying free of medical clutches- that's my goal.  It's my life plan as I enter my 8th decade. And the Covid pandemic has only made me more certain that largely avoiding Medicine will increase my chances of having a great 8th decade- and beyond. They’ll be no Covid vaccine for me- nor any other kind of vaccine. Modern Medicine is something I mostly want to to avoid, and I believe my life will be better for it.  Of course, I believe in taking care of myself with proper nutrition, exercise, and life habits, and I am doing that. There's the rub.  

This is amazing: a glib explanation of how the Covid vaccine was developed. It started with the Chinese figuring out the genome of Covid, which they published on January 10, just a month after the first cases were identified in Wuhon. Then, an American researcher took that genome, without questioning it, fed it into a computer, and it spit out the vaccine. And since then, it's been nothing but testing it on people. That's what you'll hear if you watch this:

https://www.msn.com/en-us/health/watch/scientists-moved-quickly-on-covid-vaccine-research-heres-how/vp-BB1aZpAQ?ocid=msedgdhp

Well, I went and found the published Chinese genome. I can't say I recognize all the lettering here, but I recognize some of it. Scroll down to where it says "Origin". That's what I recognize. It's the sequence of nitrogenous bases that comprise the genome. Those are the letters of the genetic alphabet, and there are four of them.: adenine, guanine, cytosine, and thymine. That's why you see in random sequence a,c,g, and t. Of course it's all scrambled as in atcgatgcagactgagatca etc. So, I get that except that in RNA there is no t. In DNA, it's t, but in RNA, it's u. Uracil replaces thymine in RNA. So, what this suggests to me is that those Chinese researchers didn't have the RNA. What they had was the manufactured and amplified DNA from the PCR test. And that's why their genome includes t instead of u.

https://www.ncbi.nlm.nih.gov/nuccore/MN908947

But, as David Crowe and Dr. Andy Kaufman have taught us, what the PCR test amplifies could be anything. And, it doesn't amplify a whole strand of DNA, rather, just a small part of it. So, how could these Chinese researchers claim to know the entire sequence of bases, nearly 30,000 of them, in Covid19? It's not as though they could look under a microscope and see all the bases. They didn't even have the whole virus. So, how did they come up with that list? It had to be done through computer modeling, where the computer compared what they came up with from the PCR test with other Corona viruses and speculated on what the entire chain was composed of. It's all computer-generated. But then what? Then we came along; accepted it all verbatim. And then we had our computers do a computer model of the vaccine based on their computer model of the viral genome. So, it's gross computer-generated speculation built upon gross computer-generated speculation. And the product of all that is what is being injected into people's bodies.

 

Jon Rappaport has an interesting post today concerning the Pfizer vaccine and all the hoopla about it. He pointed out that all they are testing for is mild sickness. They started with 43,538 healthy volunteers. Half got the vaccine, and half got placebo. Then they just waited. They figured some would get sick with Covid because "the virus is everywhere." 94 developed mild symptoms. Then, they opened the envelopes to see how many of them had received the vaccine, and 90% of them had not- implying that those that did were protected.

https://blog.nomorefakenews.com/2020/11/11/covid-vaccine-revelation-sinks-like-a-stone-disappears/

Jon's point is: What good is a vaccine that only protects against mild illness? I get it, but there is a bigger issue than that. First, what is the most distinguishing, defining characteristic of Covid? It's a positive Covid test! Nothing else. Yesterday, they told us that Covid patients can present with blood sugar disturbance. And mild symptoms can occur from the usual causes like colds and flu. I read the fine print, and they did not consider whether any of the test subjects became asymptomatic carriers over the course of the study. But, isn't that how Covid affects a lot of people? If they were going to go by mild symptoms, they should have taken it all the way down to no symptoms. And if a subject did develop symptoms, without a positive Covid test it means nothing.

So, they went about this all wrong. The positive test is what matters, not the symptoms.

Don't get me wrong: I think the test is bull shit. But, they believe in it, and that's what they have to go by because, according to them, Covid infection can exist with or without symptoms.

So, did they determine a negative Covid status in every subject at the outset? Obviously, they should have. And then, did they determine a positive Covid test result in those who developed symptoms? This is what it said: "Volunteers were tested for the virus only if they reported symptoms."

That is crap. The paradigm is that when Covid infects you the symptoms range from nothing to death and everything in-between. There is NO symptom that is pathognomonic for Covid. The only thing that is pathognomonic for Covid is a positive Covid test. So, they are going about this all wrong.

And it's especially true when you consider that it involved 43,538 people. It means that the effect that it had on 43,444 of those people is being ignored. Every single one of them should be tested for Covid positivity. This is crap. However, I also have a question for Jon Rappaport. Pfizer is saying that of the 94 people who developed mild symptoms, 90% did not receive the vaccine. How do we explain that? I mean: how do we explain it outside their paradigm of the vaccine protecting them? I don't claim to know. I can only speculate. Were there subtle design flaws? How did they determine who would get the vaccine and who would get the placebo? Was it random? And without any hitches? And since they were looking for mild acute symptoms like fever and coughing, is it possible that their vaccine has a suppressive effect? Again, I am just speculating. But, I still maintain that they went about this all wrong. What they should have done is taken their 43,538 subjects, made sure that they were Covid-negative starting out, and then determined if they registered a positive Covid test over time. That should have been the criteria. That way, they would be assessing the results in 43,538 people rather than a measly 94. What a travesty this is.

 

They say Trump has been campaigning 16 hours a day. Didn't he have Covid recently? Wasn't he in and out of the hospital in 3 days? And just think: he's in a high-risk group for serious Covid for being old (70s) and borderline obese. And yet, he sailed right through it. But, we're supposed to believe that a healthy, robust 18 year old athlete got hit with it, and it went straight to his heart and caused cardiac arrest, killing him.

What sense does that make? It makes no sense.. There isn't even a theoretical explanation for it, and they're pretty good at coming up with theoretical explanations. They love spewin' 'em.

And it looks like Trump isn't going to be a "long-hauler." Again, how are all these young people turning into long-haulers but not Trump? Well, I have been reading about the long-haulers, and I am seeing a similarity to other conditions, what I call basket conditions. I mean things like "Chronic Fatigue Syndrome" and "fibromyalgia."

Another example is Chronic Lyme Disease. I've encountered quite a few people who have been told they have that even though they've never been within 50 miles of a deer tick in their lives.

So, it looks like "long-haul Covid" is going to be the new basket disease of the 2020s.

Medicine loves labels, and they love coming up with new disorders. But, Covid is going to be like the Amazon River, collecting tributaries from most of South America, collecting so much water, that it pushes its plume 250 miles out into the Atlantic Ocean. Yes, Covid will be the Amazon of diseases.

 

The news has been all bad with reports of surging cases, increased hospitalizations, and rising death counts. Yet, the Covid attributions continue to shock me. For instance, there was an 18 year old male college student who tested negative repeatedly, but shortly before he died of sudden cardiac arrest, they said he tested positive for Covid. So, they assume his cardiac arrest was due to Covid. However, the tragic truth is that there were sudden deaths by cardiac arrest among college students, and particularly male athletes, long before there was Covid. So, what evidence is there that in his case it was caused by Covid? Is it just because of the positive Covid test? If so, that's crazy. 

And there is no good news on the vaccine front. One subject died, and they had to suspend the whole study. At least two other studies got suspended because of adverse effects among participants. There are, of course, great expectations about the vaccine, which is encouraged by government and media.  A lot of people see this ending with them announcing the availability of a vaccine; then everybody takes it; then, the pandemic is over and life goes back to normal. Well, that is a pipedream, and even Dr. Anthony Fauci says that people will still have to wear the masks after there is a vaccine.

Will the vaccine be safe and effective? Well, they are going to say that it is, but these are the same people who said that the air at Ground Zero was safe to breathe after 9/11.

As far as safety goes, they are going to test it for a number of weeks, perhaps 8 or 12, looking for adverse effects within that timeframe. However, we know that it can take longer than 12 weeks for the toxic effects of drugs or vaccines to manifest. All the toxic drugs that you can think of, such as thalidomide, appeared to be safe during their brief trials .So, you should know that, if you take the vaccine, you will be a guinea pig. 

Will the vaccine be effective? Well, the CDC, which is strongly biased in favor of the flu vaccine, has never claimed higher than 60% effectiveness for it. Last year, they claimed 37% effectiveness. That meant that for every 3 unvaccinated people who got the flu, 2 vaccinated people got it. It works except when it doesn't. Do you think it is going to be better for the Covid vaccine? Why?

If you are wondering when life is going to go back to normal, it may never. As long as they keep doing that PCR Covid test, people will continue to test positive for it. Animals have tested positive. Inanimate objects have tested positive. And as long as you run enough cycles, anyone and everyone will test positive.

It reminds me of the question: when are interest rates going to go back to normal? When I was young, you could get a passbook savings account that paid 5 percent interest. When is that coming back? It’s not. The debt of the U.S. government is so great, that if they had to pay anything close to normal interest rates, there would be a collapse. Every cent they take in would have to go to paying interest. They'd have nothing left for all the wars they love to wage. We are in a zero or near zero percent interest rate environment indefinitely. It is never going back to real interest rates. And likewise, there is no basis to think that going back to the pre-Covid world is even on the distant horizon. It seems like the good old days now though, doesn’t it?

Tonight, I read an article about the Covid long-haulers, and their symptoms run the gamut. They aren’t necessarily respiratory. They can be digestive, cardiac, cognitive, you name it. How a respiratory virus can do all that is inexplicable. What they are talking about is really unprecedented. And I dare say that there is no basis for anyone to have an understanding of it. I have yet to meet anyone who has had Covid. Everything I know about it is from what the Media tells me, and it is impossible for me to connect it to life as I know it and have always understood it.  

But, like everyone, I have to function in the Covid world. I wear the mask when I go shopping or to the post office. But any time I can get away with not wearing it, I don’t wear it. I do not insist on it in my home, and so far, no one who has visited me or stayed with me has had any desire to go around the house wearing a mask. Thank God. I hope you realize that I do consider it nonsense. I wear it only when I have to; when I am forced to by law.

I think the whole world has gone crazy, and I think the medical profession is at the core of the craziness. And I really, truly despise them for it- that life has come to this because of them.

And it's not for myself that I mourn. I'm 70 years old. I've lived most of my life. But, what about the kids who are being born into a Covid world? Just think: that is all they are going to know. 

And the only way I am going to take a Covid vaccine is if big strong men come and hold me down and jab a needle in my arm.  And they better be awfully big and awfully strong because I am going to fight like a mutha----.  

We see a lot of pictures of men and occasionally women showing off their rock-hard abs, where the abdominal wall is deeply muscled, tense and hard. This is supposed to be attractive and desirable. However, it makes me shutter, and that’s because I know more about the abdominal muscles and their function than they do.

The abdominal muscles have two main functions: to support the abdominal organs and to participate in respiration.

In regard to the first, the abdominal muscles support your organs against gravity and against the effect of various movements that you do. The abdominal muscles hold your organs in place. But, remember that these organs have movements of their own, that they are moving around inside your abdomen. So, although they need support, they also need freedom. You might say they need breathing room. And the conditions within your abdomen change a lot. At times, your stomach is just an empty sack. At other times, it’s a full sack. And when it’s full, there has to be an accommodation. So, you want the muscular wall in front to be well toned, for sure, but you also want it to be flexible and yielding.  Can it be too tight? You’re darn-tooting it can be too tight. You don’t want a 6-pack there; you want a well-toned trampoline. The trampoline is in front rather than below, but it’s still like a trampoline. You don’t want your organs to be encumbered and restricted by it. You don’t want a rigid wall there.

Regarding the second function, pertaining to respiration, the abdominal muscles contract when you expire. They help push the air out.  But then, at the end of expiration, when the next cycle is about to begin, the abdominal muscles have to relax. That’s because the diaphragm has to descend to create more space and a vacuum in the lungs. Remember that air is under pressure, and all it takes to get it to move into your lungs is to create a vacuum. You shouldn’t have to suck the air in. It should go in all by itself.

So, in the process of breathing, the abdominal muscles are alternately contracting and relaxing, contracting and relaxing, contracting and relaxing, over and over again, in an endless cycle until you take your last breath.  So, you want the abdominal muscles to be well toned, but you don’t want them to be overly tense and hard. You want a very easy, fluid, seamless transition between the two. An overly tense, rigid, and contracted abdominal wall is not going to support respiration as well as one that is toned, springy, resilient, with a quality of ease to it. You want support in your abdomen; but you also want ease.

So, it is possible to have too much of a good thing, and overly contracted and seemingly spasmodic abdominal muscles is definitely not something you should want or pursue.

So, work at staying in shape, but don’t get your freak on about it. In other words: DON’T BECOME A FREAK.

 

There is a lot written in the medical literature about the overdiagnosis and overtreatment of prostate cancer. Most prostate cancers are very slow-growing and remain confined to the prostate gland, and as a result, a man may go years or even decades without having clinical problems from it. And especially in the case of older men, the wisest course may be to just do nothing. And that is certainly my attitude. I am 70 years, and I don’t know if I have prostate cancer or not. I could. They say that if you live long enough that you’re likely to get it, that 90% of men who die over the age of 80 have some cancerous tissue in their prostate. But, as long as I am feeling good and have no pain and can pass my urine fine, I’m not that interested in finding out.

Treating prostate cancer is an industry, and it is self-propelling. However, the overtreatment is not entirely their fault because some men, upon being told they have prostate cancer, panic. They want it out. Cut it out, burn it out, get it out of me. They want aggressive treatment. They can’t stand the thought of doing nothing. They become obsessed with it. They can almost feel it growing inside them. But, it’s all in their mind.

The fact is that most of us have probably already had cancer. It starts with just one malignant cell. That doubles to 2, the two double to 4, the 4 to 8, etc. etc. but it takes a long time to reach significance, and before it does, the immune system may tackle it and get rid of it. Some of us may have already recovered from cancer several times in our lives, without ever knowing it. So, if I knew I had prostate cancer, I would not freak out about it, and I would not assume the worst.

However, I am very much in favor of a pro-active approach to prostate cancer. This involves lifestyle, diet and exercise.  For diet, it’s unrefined plant foods. I have to think that animal proteins stimulate growth within the prostate much more than plant proteins.  And there are studies showing reduced risk of prostate cancer from switching to plant proteins, such as nuts, seeds, and beans. And then there are the many anti-cancer compounds in fruits and vegetables. If you eat primarily or exclusively unrefined plant foods, you will not only lower your risk of getting prostate cancer, but you will greatly reduce your risk of developing aggressive prostate cancer. So, eating the right foods is priority number one.

Then, exercise is important because it relieves vascular congestion within the prostate. When you’re sitting a lot, a lot of people work sitting at computers and whatnot, blood tends to pool in the prostate. And that pooling of blood, that chronic vascular congestion, is conducive to morbid changes, including cancer. So getting up and running around, which drives blood from your core to your periphery, to your arms and legs, relieves that congestion, and helps keep the prostate healthy.  So, wring out your prostate with a good workout, and do it regularly.

Weight control is also important. Get lean and stay lean. Obesity is a major risk factor for aggressive prostate cancer. But, if you are eating whole natural plant foods and exercising, obesity is probably not going to be a problem.

But, more specifically than that, avoid having a pendulous abdomen. Don’t carry extra weight there. That’s because the prostate is the low man on the totem pole. The weight of everything else is weighing on it. And when that happens, it results in poor vascular drainage. And that results in a chronic torpid state of the gland.  And that encourages cancer.

So, stay light, stay lean, and stay active, and you’ll be treating your prostate gland properly.

There are many good prostate formulas that are meant to be taken preventively. I take one. I take the one that we sell called Prostathera. It is a very good product, although there are similar ones from other companies that are just as good. They usually contain botanicals like saw palmetto, pygeum, stinging nettle, plus nutrients like lycopene. And these ingredients have been shown to help mitigate benign prostatic enlargement, which is even more common than prostate cancer.  

https://klaire.com/prt-prostathera

I want to finish this by discussing the role of sex in prostate cancer. Some men fear that having sex and ejaculating too frequently may stimulate prostate cancer. Obviously, during sex, your prostate does become engorged.  But, it is just as likely that having sex and orgasms too infrequently is a culprit.  There is no doubt that staying sexually active, with a relatively high rate of frequency, is healthy for men and in numerous ways. But, there’s a caveat, and it is: DON’T ALLOW YOURSELF TO BECOME AROUSED IF THERE ISN’T GOING TO BE A RELEASE.  There is a prostatic congestion that happens, and that congestion dissipates after orgasm and ejaculation.  But, if you get aroused without climaxing, then the congestion does not go away.  Eventually, it will, but it happens much more slowly.

I’m sure you’ve heard that chronic inflammation is a progenitor of cancer; that it leads to cancer. Well, engorgement of the prostate gland during sexual arousal isn’t exactly the same as inflammation, but, it has features in common with it. And you definitely want that engorgement to go away when you’re finished having sex. So, only let yourself get sexually aroused when you know it is a situation in which completion is going to occur. Otherwise, hold off, and don’t even get started. That’s my best advice. Don’t toy with your prostate.  

 

  

More Articles...